Mature sequence oha-miR-199b-3p

Accession numberMIMAT0036792
IDoha-miR-199b-3p
Stem-Loop oha-mir-199b
Sequence
acaguaguuugcacauugauua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).