Mature sequence tch-miR-455-3p

Accession numberMIMAT0036608
IDtch-miR-455-3p
Stem-Loop tch-mir-455
Sequence
gcaguccaugggcauauacacu
Get sequence
Deep sequencing reads, experiments

References

1