Mature sequence tch-miR-26b-5p

Accession numberMIMAT0036550
IDtch-miR-26b-5p
Stem-Loop tch-mir-26b
Sequence
uucaaguaauucaggauagguu
Get sequence
Deep sequencing reads, experiments

References

1