Mature sequence tch-miR-342-3p

Accession numberMIMAT0036487
IDtch-miR-342-3p
Stem-Loop tch-mir-342
Sequence
ucucacacagaaaucgcacccgu
Get sequence
Deep sequencing reads, experiments

References

1