Mature sequence tch-miR-143-3p

Accession numberMIMAT0036476
IDtch-miR-143-3p
Stem-Loop tch-mir-143
Sequence
ugagaugaagcacuguagcucg
Get sequence
Deep sequencing reads, experiments

References

1