Mature sequence tch-miR-142

• Accession number: MIMAT0036470
• ID: tch-miR-142
• Stem-Loop: tch-mir-142
• Sequence: guaguguuuccuacuuuaugga
• Deep sequencing: reads, experiments

References

1. PMID:24314655 "microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture" Xu G, Gao Z, He W, Ma Y, Feng X, Cai T, Lu F, Liu L, Li W Virology. 448:247-254(2014).