Mature sequence tch-miR-142

Accession numberMIMAT0036470
IDtch-miR-142
Stem-Loop tch-mir-142
Sequence
guaguguuuccuacuuuaugga
Get sequence
Deep sequencing reads, experiments

References

1