Mature sequence tch-miR-210

Accession numberMIMAT0036464
IDtch-miR-210
Stem-Loop tch-mir-210
Sequence
cugugcgugugacagcggcuga
Get sequence
Deep sequencing reads, experiments

References

1