Mature sequence mmu-miR-9769-5p

Accession numberMIMAT0036461
IDmmu-miR-9769-5p
Stem-Loop mmu-mir-9769
Sequence
aggcacagaauuaggcccgacc
Get sequence
Deep sequencing5 reads, 4 experiments
Predicted targets

References

1
PMID:24235016 "Extremely complex populations of small RNAs in the mouse retina and RPE/choroid" Soundara Pandi SP, Chen M, Guduric-Fuchs J, Xu H, Simpson DA Invest Ophthalmol Vis Sci. 54:8140-8151(2013).