Mature sequence ggo-miR-515-5p

Accession numberMIMAT0036405
IDggo-miR-515-5p
Stem-Loop ggo-mir-515-1 ggo-mir-515-2
Sequence
uucuccaaaagaaagcacuuucug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).