Mature sequence gma-miR9767

Accession numberMIMAT0036404
IDgma-miR9767
Stem-Loop gma-MIR9767
Sequence
auggaaugguuacuuaugaaaaga
Get sequence
Deep sequencing reads, experiments

References

1