Mature sequence gma-miR9763

Accession numberMIMAT0036400
IDgma-miR9763
Stem-Loop gma-MIR9763
Sequence
acccauccaacucugaagaua
Get sequence
Deep sequencing reads, experiments

References

1