Mature sequence gma-miR319q

Accession numberMIMAT0036398
IDgma-miR319q
Stem-Loop gma-MIR319q
Sequence
uggacugaagggagcuccuuc
Get sequence
Deep sequencing reads, experiments

References

1