Mature sequence gma-miR9760

Accession numberMIMAT0036395
IDgma-miR9760
Stem-Loop gma-MIR9760
Sequence
uggaugauguaguuuugauug
Get sequence
Deep sequencing reads, experiments

References

1