Mature sequence gma-miR4348c

Accession numberMIMAT0036389
IDgma-miR4348c
Stem-Loop gma-MIR4348c
Sequence
uguuaaacuugcaagaugaca
Get sequence
Deep sequencing reads, experiments

References

1