Mature sequence gma-miR9753

Accession numberMIMAT0036384
IDgma-miR9753
Stem-Loop gma-MIR9753
Sequence
acaauuugggacuuagggcuacaa
Get sequence
Deep sequencing reads, experiments

References

1