Mature sequence gma-miR9746i

Accession numberMIMAT0036383
IDgma-miR9746i
Stem-Loop gma-MIR9746i
Sequence
aaaguguuugaauuucaauuagau
Get sequence
Deep sequencing reads, experiments

References

1