Mature sequence gma-miR319o

Accession numberMIMAT0036377
IDgma-miR319o
Stem-Loop gma-MIR319o
Sequence
uggacugaaggggagcuccuuc
Get sequence
Deep sequencing reads, experiments

References

1