Mature sequence gma-miR9747

Accession numberMIMAT0036374
IDgma-miR9747
Stem-Loop gma-MIR9747
Sequence
caugcgaugauuuaaauacuuu
Get sequence
Deep sequencing reads, experiments

References

1