Mature sequence gma-miR9746h

Accession numberMIMAT0036373
IDgma-miR9746h
Stem-Loop gma-MIR9746h
Sequence
aaaguguuugaaucucaauuagau
Get sequence
Deep sequencing reads, experiments

References

1