Mature sequence gma-miR9746g

Accession numberMIMAT0036372
IDgma-miR9746g
Stem-Loop gma-MIR9746g
Sequence
aaaguguuugaaucucaauuagau
Get sequence
Deep sequencing reads, experiments

References

1