Mature sequence gma-miR9746f

Accession numberMIMAT0036371
IDgma-miR9746f
Stem-Loop gma-MIR9746f
Sequence
aaaguguuugaaucucaauuagau
Get sequence
Deep sequencing reads, experiments

References

1