Mature sequence gma-miR9746e

Accession numberMIMAT0036370
IDgma-miR9746e
Stem-Loop gma-MIR9746e
Sequence
aaaguguuugaaucucaauuagau
Get sequence
Deep sequencing reads, experiments

References

1