Mature sequence gma-miR9746d

Accession numberMIMAT0036369
IDgma-miR9746d
Stem-Loop gma-MIR9746d
Sequence
aaaguguuugaaucucaauuagau
Get sequence
Deep sequencing reads, experiments

References

1