Mature sequence gma-miR9746c

Accession numberMIMAT0036368
IDgma-miR9746c
Stem-Loop gma-MIR9746c
Sequence
aaaguguuugaaucucaauuagau
Get sequence
Deep sequencing reads, experiments

References

1