Mature sequence gma-miR9746b

Accession numberMIMAT0036367
IDgma-miR9746b
Stem-Loop gma-MIR9746b
Sequence
aaaguguuugaaucucaauuagau
Get sequence
Deep sequencing reads, experiments

References

1