Mature sequence gma-miR9746a

Accession numberMIMAT0036366
IDgma-miR9746a
Stem-Loop gma-MIR9746a
Sequence
aaaguguuugaaucucaauuagau
Get sequence
Deep sequencing reads, experiments

References

1