Mature sequence gma-miR9727

Accession numberMIMAT0036345
IDgma-miR9727
Stem-Loop gma-MIR9727
Sequence
ugaaguuacucugagcacugag
Get sequence
Deep sequencing reads, experiments

References

1