Mature sequence gma-miR4348b

Accession numberMIMAT0036344
IDgma-miR4348b
Stem-Loop gma-MIR4348b
Sequence
ucuuuugaauuugacuauuag
Get sequence
Deep sequencing reads, experiments

References

1