Mature sequence gma-miR398d

Accession numberMIMAT0036343
IDgma-miR398d
Stem-Loop gma-MIR398d
Sequence
uguguucucaggucgccccug
Get sequence
Deep sequencing reads, experiments

References

1