Mature sequence ocu-miR-191-3p

Accession numberMIMAT0036336
IDocu-miR-191-3p
Stem-Loop ocu-mir-191
Sequence
gcugcgcuuggauuucguuccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23426804 "Discovery of pluripotency-associated microRNAs in rabbit preimplantation embryos and embryonic stem-like cells" Maraghechi P, Hiripi L, Toth G, Bontovics B, Bosze Z, Gocza E Reproduction. 145:421-437(2013).
2
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).