Mature sequence chi-miR-92b

Accession numberMIMAT0036304
IDchi-miR-92b
Stem-Loop chi-mir-92b
Sequence
uauugcacuugucccggccugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).