Mature sequence chi-miR-433

Accession numberMIMAT0036229
IDchi-miR-433
Stem-Loop chi-mir-433
Sequence
aucaugaugggcuccucggugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).