Mature sequence chi-miR-377

Accession numberMIMAT0036192
IDchi-miR-377
Stem-Loop chi-mir-377
Sequence
aaucacacaaaggcaacuuuug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).