Mature sequence chi-miR-23a

Accession numberMIMAT0036087
IDchi-miR-23a
Stem-Loop chi-mir-23a
Sequence
aucacauugccagggauuucc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).