Mature sequence chi-miR-2320

Accession numberMIMAT0036083
IDchi-miR-2320
Stem-Loop chi-mir-2320
Sequence
ucgaugauggucccuguguuuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).