Mature sequence chi-miR-200a

Accession numberMIMAT0036045
IDchi-miR-200a
Stem-Loop chi-mir-200a
Sequence
uaacacugucugguaacgaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).