Mature sequence chi-miR-182

Accession numberMIMAT0036006
IDchi-miR-182
Stem-Loop chi-mir-182
Sequence
uuuggcaaugguagaacucac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).