Mature sequence chi-miR-146a

Accession numberMIMAT0035971
IDchi-miR-146a
Stem-Loop chi-mir-146a
Sequence
ugagaacugaauuccauagguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).