Mature sequence chi-miR-141

Accession numberMIMAT0035962
IDchi-miR-141
Stem-Loop chi-mir-141
Sequence
uaacacugucugguaaagaugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).