Mature sequence chi-miR-1343

Accession numberMIMAT0035950
IDchi-miR-1343
Stem-Loop chi-mir-1343
Sequence
cuccuggggcccgcacucucgc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).