Mature sequence bra-miR172d-3p

Accession numberMIMAT0035877
IDbra-miR172d-3p
Stem-Loop bra-MIR172d
Sequence
ggaaucuugaugaugcugcau
Get sequence
Deep sequencing reads, experiments

References

1