Mature sequence bra-miR172d-5p

Accession numberMIMAT0035876
IDbra-miR172d-5p
Stem-Loop bra-MIR172d
Sequence
gcagcaucauuaagauucaca
Get sequence
Deep sequencing reads, experiments

References

1