Mature sequence bra-miR2111-3p

Accession numberMIMAT0035875
IDbra-miR2111-3p
Stem-Loop bra-MIR2111
Sequence
gaccucaggaugcggauuacc
Get sequence
Deep sequencing reads, experiments

References

1