Mature sequence bra-miR172c-5p

Accession numberMIMAT0035872
IDbra-miR172c-5p
Stem-Loop bra-MIR172c
Sequence
gcaucaucaucaagauucaga
Get sequence
Deep sequencing reads, experiments

References

1