Mature sequence bra-miR6032-5p

Accession numberMIMAT0035862
IDbra-miR6032-5p
Stem-Loop bra-MIR6032
Sequence
aacauggagcaucaacagauc
Get sequence
Deep sequencing reads, experiments

References

1