Mature sequence bra-miR395a-3p

Accession numberMIMAT0035851
IDbra-miR395a-3p
Stem-Loop bra-MIR395a
Sequence
cugaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1