Mature sequence bra-miR395a-5p

Accession numberMIMAT0035850
IDbra-miR395a-5p
Stem-Loop bra-MIR395a
Sequence
guuccucugagcacuucauug
Get sequence
Deep sequencing reads, experiments

References

1