Mature sequence bra-miR162-3p

Accession numberMIMAT0035831
IDbra-miR162-3p
Stem-Loop bra-MIR162
Sequence
ucgauaaaccucugcauccag
Get sequence
Deep sequencing reads, experiments

References

1