Mature sequence bra-miR162-5p

Accession numberMIMAT0035830
IDbra-miR162-5p
Stem-Loop bra-MIR162
Sequence
ggaggcagcgguucaucgauc
Get sequence
Deep sequencing reads, experiments

References

1