Mature sequence tae-miR9674b-5p

Accession numberMIMAT0035801
IDtae-miR9674b-5p
Sequence
auagcaucauccauccuaccc
Get sequence
Stem-Loop tae-MIR9674b

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).