Mature sequence tae-miR9674b-5p

Accession numberMIMAT0035801
IDtae-miR9674b-5p
Stem-Loop tae-MIR9674b
Sequence
auagcaucauccauccuaccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).